lgals3bpb

Ensembl ID:
ENSDARG00000040528
ZFIN ID:
ZDB-GENE-040426-2262
Description:
Galectin-3-binding protein B [Source:UniProtKB/Swiss-Prot;Acc:Q6NY73]
Human Orthologue:
LGALS3BP
Human Description:
lectin, galactoside-binding, soluble, 3 binding protein [Source:HGNC Symbol;Acc:6564]
Mouse Orthologue:
Lgals3bp
Mouse Description:
lectin, galactoside-binding, soluble, 3 binding protein Gene [Source:MGI Symbol;Acc:MGI:99554]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa5233 Nonsense Mutation detected in F1 DNA During 2014
sa15385 Nonsense Available for shipment Available now
sa18128 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa5233
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059314 Nonsense 6 561 1 6
ENSDART00000101829 Nonsense 5 572 1 5
ENSDART00000059314 Nonsense 6 561 1 6
ENSDART00000101829 Nonsense 5 572 1 5
Genomic Location:
Chromosome 3 (position 58558137)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGAATTGCATCCTTGTCGTTGCTGTTTCTGACATCATGTTGCTCCTGTG[G/A]CCTCTACTGTTTCTTCARGTTTCYGCACTGCGCCGGACCTTGTTTGGTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15385
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059314 Nonsense 6 561 1 6
ENSDART00000101829 Nonsense 5 572 1 5
ENSDART00000059314 Nonsense 6 561 1 6
ENSDART00000101829 Nonsense 5 572 1 5
Genomic Location:
Chromosome 3 (position 58558137)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGAATTGCRTCCTTGTCRTTGCTGTTTCTGACATCATGTTGCTCCTGTG[G/A]CCTCTACTGTTTCTTCARGTTTCYGCACTGCGCCGGACCTTGTTTGGTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18128
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059314 Nonsense 84 561 2 6
ENSDART00000101829 Nonsense 85 572 2 5
Genomic Location:
Chromosome 3 (position 58557781)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTGTCGTCAGCTGGGTTTTCCTGGAGCCGTATCAGTTGCTACTGGAGGA[C/T]AATATGGTGAAGGTACRAACTCCACTGTGCAGTTTGATTGCCACCTTTAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/9oksifkk