lgals3bpb

Ensembl ID:
ENSDARG00000040528
ZFIN ID:
ZDB-GENE-040426-2262
Description:
Galectin-3-binding protein B [Source:UniProtKB/Swiss-Prot;Acc:Q6NY73]
Human Orthologue:
LGALS3BP
Human Description:
lectin, galactoside-binding, soluble, 3 binding protein [Source:HGNC Symbol;Acc:6564]
Mouse Orthologue:
Lgals3bp
Mouse Description:
lectin, galactoside-binding, soluble, 3 binding protein Gene [Source:MGI Symbol;Acc:MGI:99554]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15385 Nonsense Available for shipment Available now
sa18128 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15385
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059314 Nonsense 6 561 1 6
ENSDART00000101829 Nonsense 5 572 1 5
ENSDART00000059314 Nonsense 6 561 1 6
ENSDART00000101829 Nonsense 5 572 1 5
Genomic Location (Zv9):
Chromosome 3 (position 58558137)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 57673725
KASP Assay ID:
2259-4207.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGAATTGCRTCCTTGTCRTTGCTGTTTCTGACATCATGTTGCTCCTGTG[G/A]CCTCTACTGTTTCTTCARGTTTCYGCACTGCGCCGGACCTTGTTTGGTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18128
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059314 Nonsense 84 561 2 6
ENSDART00000101829 Nonsense 85 572 2 5
Genomic Location (Zv9):
Chromosome 3 (position 58557781)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 57673369
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTGTCGTCAGCTGGGTTTTCCTGGAGCCGTATCAGTTGCTACTGGAGGA[C/T]AATATGGTGAAGGTACRAACTCCACTGTGCAGTTTGATTGCCACCTTTAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link