ca15b

Ensembl ID:
ENSDARG00000040510
ZFIN ID:
ZDB-GENE-040426-2222
Description:
carbonic anhydrase XV b [Source:RefSeq peptide;Acc:NP_998347]
Human Orthologue:
CA4
Human Description:
carbonic anhydrase IV [Source:HGNC Symbol;Acc:1375]
Mouse Orthologue:
Car4
Mouse Description:
carbonic anhydrase 4 Gene [Source:MGI Symbol;Acc:MGI:1096574]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17825 Nonsense Available for shipment Available now
sa22006 Essential Splice Site Available for shipment Available now
sa35195 Essential Splice Site Mutation detected in F1 DNA During 2016
sa8484 Essential Splice Site Mutation detected in F1 DNA During 2016
sa27866 Missense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa17825
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008362 Nonsense 36 305 4 9
Genomic Location (Zv9):
Chromosome 12 (position 4980137)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 4262764
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGAAGTCACATGGCCCATCAYTGCAGAAAAACACTGTAACGGCACTCAA[C/T]ARTCTCCAATAAACATYGTAACYGCTAATGTCAAGGCTAATGCTAATTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22006
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008362 Essential Splice Site 76 305 5 9
Genomic Location (Zv9):
Chromosome 12 (position 4979947)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 4262574
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTATTCAATTTTCCGCAAGGTTTTTAATGAATGTTTAACCAGTGTTTTAA[G/A]TTCAAGTTACGTTGGATCCGAAGAAGATGCGTGTGGCAGGGGGTAATCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35195
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008362 Essential Splice Site 149 305 6 9
Genomic Location (Zv9):
Chromosome 12 (position 4978940)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 4261567
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTCAGTAACACCAGTGATTCGTTGGCAGTTCTTGGTGTCTTCATTGAGG[T/C]ATACTGACTTTTACTCATATTTGAGATGCAACTTAAGAGGTGGATGATGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8484
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008362 Essential Splice Site 150 305 7 9
Genomic Location (Zv9):
Chromosome 12 (position 4978871)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 4261498
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTTGAGRTGCAACTTRAGAGKTGGATGATKGAATTNGTAATCTCACCCTC[A/G]GGCCTCTAATGAAACTGGRAAACCTGAGAGCTGGAAGACTTTAACGTCGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27866
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > C
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008362 Missense 159 305 7 9
Genomic Location (Zv9):
Chromosome 12 (position 4978842)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 4261469
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGAATTGTAATCTCACCCTCAGGCCTCTAATGAAACTGGGAAACCTGAG[A/C]GCTGGAAGACTTTAACGTCGTATCTTACAAGGATTGTCAAAGCAGGTGAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link