mthfd1

Ensembl ID:
ENSDARG00000040492
ZFIN ID:
ZDB-GENE-020905-4
Description:
C-1-tetrahydrofolate synthase, cytoplasmic [Source:RefSeq peptide;Acc:NP_955823]
Human Orthologue:
MTHFD1
Human Description:
methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1, methenyltetrahydrofolate cyclohydrolase
Mouse Orthologue:
Mthfd1
Mouse Description:
methylenetetrahydrofolate dehydrogenase (NADP+ dependent), methenyltetrahydrofolate cyclohydrolase,

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa473 Nonsense Confirmed mutation in F2 line During 2014
sa3990 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa473
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021950 Nonsense 615 934 19 28
Genomic Location:
Chromosome 17 (position 49524061)
KASP Assay ID:
554-0205.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAAGTTTTGTTTGTTTTAGGGAGTGTGTGGAGCTCTGACAGTCCTCATG[C/T]GAGATGCTATCAAGCCAAACCTCATGCAGACTCTGGAGGTGAGTGTTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3990
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021950 Nonsense 815 934 24 28
Genomic Location:
Chromosome 17 (position 49515226)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGAGCTGTTCAAAGAGCTGCAGACCTGCCCAAMAGCTTCCAATTTCTCTA[T/A]GATGTTCAGGTAAAAATAAAGCAGAATGTTAGTACTGTTGCATTAAAACT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/3m82znom