dusp19

Ensembl ID:
ENSDARG00000040490
ZFIN ID:
ZDB-GENE-081104-382
Description:
dual specificity protein phosphatase 19 [Source:RefSeq peptide;Acc:NP_001121737]
Human Orthologue:
DUSP19
Human Description:
dual specificity phosphatase 19 [Source:HGNC Symbol;Acc:18894]
Mouse Orthologue:
Dusp19
Mouse Description:
dual specificity phosphatase 19 Gene [Source:MGI Symbol;Acc:MGI:1915332]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14404 Nonsense Available for shipment Available now
sa21591 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14404
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059261 Nonsense 67 213 1 4
Genomic Location (Zv9):
Chromosome 9 (position 45785674)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 44917339
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTCCATGTGGATATGTTCAGGATAATAACKGGGATCTCCAGGTTGGATA[T/A]GTTAAACCATATCTACTTCTTGGTGAGTATTGTTGATGTTCTTGAGTGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21591
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059261 Nonsense 187 213 4 4
Genomic Location (Zv9):
Chromosome 9 (position 45780774)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 44912439
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGATTTGGTGACACGTTTGCCCTGGTGAAATCAGCTCGACCCGCCTCGTG[T/A]CCAAATCCAGGGTTCATGGAACAGCTGAAAAACTTCAAACCGCAAGACGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link