dfna5

Ensembl ID:
ENSDARG00000040485
ZFIN ID:
ZDB-GENE-030131-7662
Description:
deafness, autosomal dominant 5 [Source:RefSeq peptide;Acc:NP_001001947]
Human Orthologue:
DFNA5
Human Description:
deafness, autosomal dominant 5 [Source:HGNC Symbol;Acc:2810]
Mouse Orthologue:
Dfna5
Mouse Description:
deafness, autosomal dominant 5 (human) Gene [Source:MGI Symbol;Acc:MGI:1889850]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42706 Nonsense Mutation detected in F1 DNA During 2017
sa36101 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa42706
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059252 Nonsense 51 472 2 10
ENSDART00000125763 Nonsense 51 472 1 9
ENSDART00000137951 Nonsense 51 106 2 3
Genomic Location (Zv9):
Chromosome 16 (position 23511144)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 21620895
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCGCTGGTCATCAAGCGTAACCGATACTGGTTTTGGCAGCAACCCAAATA[C/A]AAGCCAACAGACTTCAAACTGAGTGATGTTCTAGTTGGAGATCCCATAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36101
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059252 Essential Splice Site 271 472 6 10
ENSDART00000125763 Essential Splice Site 271 472 5 9
ENSDART00000137951   None 106 None 3
Genomic Location (Zv9):
Chromosome 16 (position 23514916)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 21624667
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTCACAGTTAGTGCTGCACCAGGGAATCCAACCCACAACATGCAGAAAG[G/A]TAACAACACATGAATGTATAAATGTTTTCAATGACATTTTTTTTTACTTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link