si:dkey-15j7.2

Ensembl ID:
ENSDARG00000040482
ZFIN ID:
ZDB-GENE-100921-38
Human Orthologue:
OSBPL3
Human Description:
oxysterol binding protein-like 3 [Source:HGNC Symbol;Acc:16370]
Mouse Orthologue:
Osbpl3
Mouse Description:
oxysterol binding protein-like 3 Gene [Source:MGI Symbol;Acc:MGI:1918970]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6425 Essential Splice Site Mutation detected in F1 DNA During 2017
sa4654 Nonsense F2 line generated During 2017
sa14092 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa6425
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059250 Essential Splice Site 460 846 12 21
ENSDART00000145886 Essential Splice Site 465 848 12 21
Genomic Location (Zv9):
Chromosome 16 (position 23449835)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 21559586
KASP Assay ID:
554-4511.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCATGGATAACTTCAGCAACGAGGCAGAGAATGAGAGACTYAATACAGG[T/C]GGGAATGACGCTTTTCTTGCCTCATGCTGCTGATTTTTCACTGTCAATCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4654
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059250 Nonsense 673 846 17 21
ENSDART00000145886 Nonsense 675 848 17 21
Genomic Location (Zv9):
Chromosome 16 (position 23483417)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 21593168
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACGCTGGATTGAGCACTATGGKGAAATTTCCATCAAAAACTCCAACAGC[G/T]AGAAATGCCAGTGCAAAGTTACCTTCATCAAGGTCAGMTGCCTCTGCTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14092
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059250 Nonsense 740 846 19 21
ENSDART00000145886 Nonsense 742 848 19 21
Genomic Location (Zv9):
Chromosome 16 (position 23491580)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 21601331
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTGTCTGTGTATGTTTATCTGTACAGATCCCATGCCTCCTGAATTTGAG[C/T]AGTACTACGGTTTTACAAAGTTTGCTATGGAGCTCAATGAGCTCGACCCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link