enpp6

Ensembl ID:
ENSDARG00000040469
ZFIN ID:
ZDB-GENE-031205-1
Description:
Ectonucleotide pyrophosphatase/phosphodiesterase family member 6 [Source:UniProtKB/Swiss-Prot;Acc:Q5
Human Orthologue:
ENPP6
Human Description:
ectonucleotide pyrophosphatase/phosphodiesterase 6 [Source:HGNC Symbol;Acc:23409]
Mouse Orthologue:
Enpp6
Mouse Description:
ectonucleotide pyrophosphatase/phosphodiesterase 6 Gene [Source:MGI Symbol;Acc:MGI:2445171]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa4547 Nonsense Mutation detected in F1 DNA During 2014
sa19075 Essential Splice Site Mutation detected in F1 DNA During 2014
sa3903 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa4547
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059231 Nonsense 137 438 2 8
Genomic Location:
Chromosome 14 (position 4239830)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGTGGGTCACCATGCAKAAACTAGGGAAAAAAGTCTATATGTACTACTG[G/A]CCAGRTTGGCRCACATCTAAYTAGTCATGAWTRAAGCACAAATSAAGTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19075
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059231 Essential Splice Site 138 438 2 8
ENSDART00000059231 Essential Splice Site 138 438 2 8
Genomic Location:
Chromosome 14 (position 4239825)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTCACCATGCAGAAACTAGGGAAAAAAGTCTATATGTACTACTGGCCAG[G/A]TTGGCGCACATCTAACTAGTCATGATTAAAGCACAAATCAAGTCTACAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3903
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059231 Essential Splice Site 138 438 2 8
ENSDART00000059231 Essential Splice Site 138 438 2 8
Genomic Location:
Chromosome 14 (position 4239825)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTCACCATGCAKAAACTAGGGAAAAAAGTCTATATGTACTACTGGCCAG[G/A]TTGGCRCACATCTAAYTAGTCATGAWTRAAGCACAAATSAAGTCTACWGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/rqfax28g