enpp6

Ensembl ID:
ENSDARG00000040469
ZFIN ID:
ZDB-GENE-031205-1
Description:
Ectonucleotide pyrophosphatase/phosphodiesterase family member 6 [Source:UniProtKB/Swiss-Prot;Acc:Q5
Human Orthologue:
ENPP6
Human Description:
ectonucleotide pyrophosphatase/phosphodiesterase 6 [Source:HGNC Symbol;Acc:23409]
Mouse Orthologue:
Enpp6
Mouse Description:
ectonucleotide pyrophosphatase/phosphodiesterase 6 Gene [Source:MGI Symbol;Acc:MGI:2445171]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa31971 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa31971
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059231 Nonsense 325 438 6 8
Genomic Location (Zv9):
Chromosome 14 (position 4231058)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 3945581
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGAATGGGCAGTTCGTCTCGACGCTAACGCTAGTCGCAGAGCCTGGATG[G/A]TTTATCACAGAGGTTAGTAAGTTTGCTCTCAGGAGTGTTTATGGCAGTGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link