IRF2 (1 of 2)

Ensembl ID:
ENSDARG00000040465
Description:
interferon regulatory factor 2 [Source:HGNC Symbol;Acc:6117]
Human Orthologue:
IRF2
Human Description:
interferon regulatory factor 2 [Source:HGNC Symbol;Acc:6117]
Mouse Orthologue:
Irf2
Mouse Description:
interferon regulatory factor 2 Gene [Source:MGI Symbol;Acc:MGI:96591]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12780 Nonsense Available for shipment Available now
sa9417 Nonsense Available for shipment Available now
sa19076 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa12780
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059230 Nonsense 19 330 1 10
Genomic Location:
Chromosome 14 (position 4291729)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGGAGAGAATGCGCATGAGGCCGTGGTTGGAGGAGCAGATAAACTCTTG[T/A]CAAATACCGGGACTYAAATGGGTCAACAAGGTACGACTGTGAGAACGGCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9417
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059230 Nonsense 173 330 6 10
ENSDART00000059230 Nonsense 173 330 6 10
Genomic Location:
Chromosome 14 (position 4279374)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACACAAGTATTTAATAAATTAAGAACAACATGGATTAAATTGACCGGCTA[T/A]ATCAACACATTCACAGTTCATGCAAAAYAAAAATGTMAAAAATTSTAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19076
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059230 Nonsense 173 330 6 10
ENSDART00000059230 Nonsense 173 330 6 10
Genomic Location:
Chromosome 14 (position 4279374)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACACAAGTATTTAATAAATTAAGAACAACATGGATTAAATTGACCGGCTA[T/A]ATCAACACATTCACAGTTCATGCAAAATAAAAATGTCAAAAATTCTAATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/72luswvr