polr2i

Ensembl ID:
ENSDARG00000040443
ZFIN ID:
ZDB-GENE-041010-106
Description:
DNA directed RNA polymerase II polypeptide I [Source:RefSeq peptide;Acc:NP_001006013]
Human Orthologue:
POLR2I
Human Description:
polymerase (RNA) II (DNA directed) polypeptide I, 14.5kDa [Source:HGNC Symbol;Acc:9196]
Mouse Orthologue:
Polr2i
Mouse Description:
polymerase (RNA) II (DNA directed) polypeptide I Gene [Source:MGI Symbol;Acc:MGI:1917170]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa10431 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa10431
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059196 Essential Splice Site 40 126 3 6
ENSDART00000098878   None 57 None 3

The following transcripts of ENSDARG00000040443 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 39209297)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 40922014
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAATGGKAAGATCTTACWTGACAGAATCTTCATTSGYATSTTGTATTTCA[G/A]TGCAGAAACTGTGACTATCAGCAGGAAGCYGACAACAGCTGCATCTATGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link