prtgb

Ensembl ID:
ENSDARG00000040442
ZFIN ID:
ZDB-GENE-060302-1
Description:
Protogenin B [Source:UniProtKB/Swiss-Prot;Acc:Q2EY13]
Human Orthologue:
PRTG
Human Description:
protogenin [Source:HGNC Symbol;Acc:26373]
Mouse Orthologue:
Prtg
Mouse Description:
protogenin homolog (Gallus gallus) Gene [Source:MGI Symbol;Acc:MGI:2444710]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16406 Nonsense Available for shipment Available now
sa24580 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa16406
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059193 Nonsense 399 904 6 16
Genomic Location (Zv9):
Chromosome 25 (position 441090)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 400195
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGGTAAACTCAGTTGAGCTGCCTGTCTCWGGTGAGAACGGCACCCAGTA[C/A]CTCCTGCAAGATCTGCAACCTGACACCATTTATCTGATCCGGATGTCWGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24580
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059193 Essential Splice Site 441 904 7 16
Genomic Location (Zv9):
Chromosome 25 (position 445918)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 405023
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGCAGTGTGGTTTTATCTTGATGTTGATTTAAGGTCTGTTTCTGCCCTC[A/G]GTGCCTCCTGCCCCAAACCTTGAGCTTGAACCTCTAAACTGCACCTCTGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link