LOC555784

Ensembl ID:
ENSDARG00000040430
Human Orthologues:
CBX6, NPTXR
Human Descriptions:
chromobox homolog 6 [Source:HGNC Symbol;Acc:1556]
neuronal pentraxin receptor [Source:HGNC Symbol;Acc:7954]
Mouse Orthologues:
Cbx6, Npcd, Nptxr
Mouse Descriptions:
chromobox homolog 6 Gene [Source:MGI Symbol;Acc:MGI:3512628]
neuronal pentraxin chromo domain Gene [Source:MGI Symbol;Acc:MGI:3845555]
neuronal pentraxin receptor Gene [Source:MGI Symbol;Acc:MGI:1920590]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa33165 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa33165
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059179 Nonsense 289 526 2 5
Genomic Location (Zv9):
Chromosome 3 (position 24779168)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 24357379
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACTGCTGGAGGAGGAGAGGAAAGCGCTACGCAAAGAGACGCAAAAACAT[C/T]AGGATCATATTGACTATGGACTGGACACTGTACACCAGCGGATCAGCAGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Bladder cancer: A multi-stage genome-wide association study of bladder cancer identifies multiple susceptibility loci. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link