si:ch211-8c17.8

Ensembl ID:
ENSDARG00000040424
ZFIN ID:
ZDB-GENE-091113-17
Human Orthologue:
CYP2W1
Human Description:
cytochrome P450, family 2, subfamily W, polypeptide 1 [Source:HGNC Symbol;Acc:20243]
Mouse Orthologue:
Cyp2w1
Mouse Description:
cytochrome P450, family 2, subfamily w, polypeptide 1 Gene [Source:MGI Symbol;Acc:MGI:3616076]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa33103 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa33103
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059171 Nonsense 133 443 3 8
ENSDART00000127868 Nonsense 11 382 1 7
ENSDART00000141470 Nonsense 136 507 3 9
Genomic Location (Zv9):
Chromosome 3 (position 12520367)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 12595282
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAATGCTTTTGTGTGGATCAGGAATCCTCTTTTCCAATGGAGAGAACTGG[A/T]AAGAGATGCGACGCTTCGCTCTCAGCAACCTGCGGGACTTTGGGATGGGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link