usp22

Ensembl ID:
ENSDARG00000040407
ZFIN ID:
ZDB-GENE-060512-211
Description:
Ubiquitin carboxyl-terminal hydrolase 22 [Source:UniProtKB/Swiss-Prot;Acc:A6H8I0]
Human Orthologues:
USP22, USP51
Human Descriptions:
ubiquitin specific peptidase 22 [Source:HGNC Symbol;Acc:12621]
ubiquitin specific peptidase 51 [Source:HGNC Symbol;Acc:23086]
Mouse Orthologues:
Usp22, Usp27x, Usp51
Mouse Descriptions:
ubiquitin specific peptidase 22 Gene [Source:MGI Symbol;Acc:MGI:2144157]
ubiquitin specific peptidase 27, X chromosome Gene [Source:MGI Symbol;Acc:MGI:1859645]
ubiquitin specific protease 51 Gene [Source:MGI Symbol;Acc:MGI:3588217]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa14142 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa14142
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059143 Essential Splice Site 403 466 10 13
Genomic Location:
Chromosome 12 (position 1699058)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGAACGGACAGTACCAGCAGCCAGTAGACTCATTAAACAATGATAACAA[G/A]TAAGTCCACGTCCATATTTATATAAAAAATATATATTCATATTATATTTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/pmedmanm