CACNA2D1 (2 of 3)

Ensembl ID:
ENSDARG00000040406
Description:
calcium channel, voltage-dependent, alpha 2/delta subunit 1 [Source:HGNC Symbol;Acc:1399]
Human Orthologue:
CACNA2D1
Human Description:
calcium channel, voltage-dependent, alpha 2/delta subunit 1 [Source:HGNC Symbol;Acc:1399]
Mouse Orthologue:
Cacna2d1
Mouse Description:
calcium channel, voltage-dependent, alpha2/delta subunit 1 Gene [Source:MGI Symbol;Acc:MGI:88295]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32189 Nonsense Mutation detected in F1 DNA During 2017
sa36581 Nonsense Mutation detected in F1 DNA During 2017
sa43055 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa32189
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077152 Nonsense 289 515 12 19
Genomic Location (Zv9):
Chromosome 18 (position 9477707)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 10048346
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGATTCTGGATGATGGAGGCTTTCTGCTCATGTCCAATCAGGAGGAATA[C/A]ATTCAGCAGGTAGGGTCAAGGGTGTAGATTTGGTTTTACACTAGTATATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36581
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077152 Nonsense 320 515 13 19
Genomic Location (Zv9):
Chromosome 18 (position 9474806)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 10045445
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGATGATCACTCTGGTCAACACATCGCTCTACTCCTTCAATAAAACCTA[C/A]GACTACCAGTCAGTCTGCGACCCTGAGAGAGAAACAAAAGCTGCCGCTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43055
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077152 Essential Splice Site 344 515 14 19
Genomic Location (Zv9):
Chromosome 18 (position 9474195)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 10044834
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTGTGTCGAGTGACCCTGTTGCATCTGTGTTTGTATATTTGTTTTTGAC[A/T]GCCAACGATAGCAGATCTGCTTACCGTGGGCTGGTGGGCTTCTACTGCCG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link