arhgef1

Ensembl ID:
ENSDARG00000040380
ZFIN ID:
ZDB-GENE-030722-5
Description:
rho guanine nucleotide exchange factor (GEF) 1 [Source:RefSeq peptide;Acc:NP_001075100]
Human Orthologue:
ARHGEF2
Human Description:
Rho/Rac guanine nucleotide exchange factor (GEF) 2 [Source:HGNC Symbol;Acc:682]
Mouse Orthologue:
Arhgef2
Mouse Description:
rho/rac guanine nucleotide exchange factor (GEF) 2 Gene [Source:MGI Symbol;Acc:MGI:103264]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23467 Essential Splice Site Mutation detected in F1 DNA During 2014
sa16009 Nonsense Available for shipment Available now
sa23466 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa23467
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059102 Essential Splice Site 98 935 3 22
ENSDART00000114710 Essential Splice Site 312 1149 8 27
Genomic Location:
Chromosome 19 (position 11569518)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAACCGCTGCAGGGACACACTACCAAACTGTGTGAAAATGAAACAAAAG[G/A]TGGGATATTAGTGCACGCATGGGTCACGTGGAATACATGAACCACTGACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16009
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059102 Nonsense 557 935 13 22
ENSDART00000114710 Nonsense 771 1149 18 27
Genomic Location:
Chromosome 19 (position 11545578)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGCGAGGSTTGTTTCTGATCAGCAGTGAGTCCAGCCCACCTGAGATGTA[C/A]GAGCTCTATGCRGCRAGCAAAGATGACAGAAACACCTGGCTTCGCCTYAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23466
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059102 Essential Splice Site 580 935 13 22
ENSDART00000114710 Essential Splice Site 794 1149 18 27
Genomic Location:
Chromosome 19 (position 11545509)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAGATGACAGAAACACCTGGCTTCGCCTTATACAGCAGACCATCGGCAG[G/A]TACAAACACATCTTTGTCTTTGCAGTGGAATTTGAAATTGCATTTCTTTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/0vwg4m0o