crot

Ensembl ID:
ENSDARG00000040352
ZFIN ID:
ZDB-GENE-050522-35
Description:
peroxisomal carnitine O-octanoyltransferase [Source:RefSeq peptide;Acc:NP_001018161]
Human Orthologue:
CROT
Human Description:
carnitine O-octanoyltransferase [Source:HGNC Symbol;Acc:2366]
Mouse Orthologue:
Crot
Mouse Description:
carnitine O-octanoyltransferase Gene [Source:MGI Symbol;Acc:MGI:1921364]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22863 Nonsense Mutation detected in F1 DNA During 2014
sa25015 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa22863
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018235 Nonsense 77 612 3 17
Genomic Location:
Chromosome 16 (position 30831517)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGGCATTGGACAAGAGCTGCACCAGAAGCTTCTTCAGAGAGCCAAGAGC[A/T]AACGTAACTGGGTAACAGGACACTGGTGTTTTCCTCTGCTGCATTGAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25015
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018235 Nonsense 489 612 14 17
Genomic Location:
Chromosome 16 (position 30852469)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTTTTACAGACTGAAGAGAAAAGACACACTTTACATGCAGCCGTCAAC[A/T]AACACAACAAGTTGATGGCAGAGGCTCAGGATGGGAAAGGTTTGTTTGCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/7pc4yckh