ephb4a

Ensembl ID:
ENSDARG00000040346
ZFIN ID:
ZDB-GENE-990415-62
Description:
eph receptor B4a [Source:RefSeq peptide;Acc:NP_571489]
Human Orthologue:
EPHB4
Human Description:
EPH receptor B4 [Source:HGNC Symbol;Acc:3395]
Mouse Orthologue:
Ephb4
Mouse Description:
Eph receptor B4 Gene [Source:MGI Symbol;Acc:MGI:104757]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11431 Nonsense Available for shipment Available now
hu3445 Nonsense Available for shipment Available now
sa13275 Nonsense Available for shipment Available now
sa33770 Nonsense Mutation detected in F1 DNA During 2016
sa30869 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa11431
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059042 Nonsense 67 989 3 18
ENSDART00000121947 Nonsense 67 987 3 17
ENSDART00000133074 Nonsense 40 960 2 16

The following transcripts of ENSDARG00000040346 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 70810152)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 67698590
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGGAGGAGGTCAGTGGTCTGGRTGAGGAGAACAACAGTGTGCGGACCTA[T/A]CAGATCTGCCAGGCGGACGGCTCCAGCAGTCATTGGCTGCGYAGTAAGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
hu3445
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059042 Nonsense 245 989 4 18
ENSDART00000121947 Nonsense 245 987 4 17
ENSDART00000133074 Nonsense 218 960 3 16

The following transcripts of ENSDARG00000040346 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 70813967)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 67694775
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAACGCAGCACAGCCTGGCCCCAGTCCCAGACCGCCCAAGATGTTCTGC[G/T]GAGAAGATGGACAGTGGGTGGACCAGCCCACCACCACCTGCACTTGCCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13275
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059042 Nonsense 362 989 6 18
ENSDART00000121947 Nonsense 362 987 6 17
ENSDART00000133074 Nonsense 335 960 5 16

The following transcripts of ENSDARG00000040346 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 70830557)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 67678185
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGGAGTGGAGYGAGCCRTTGGACAGCGGCGGCCRYTCGGATCTCAGCTA[C/A]AGSGTGGAGTGTAGGATGTGCTCCACCCCTGGAAGTCCCTGCACACTATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33770
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059042 Nonsense 515 989 8 18
ENSDART00000121947 Nonsense 515 987 8 17
ENSDART00000133074 Nonsense 488 960 7 16

The following transcripts of ENSDARG00000040346 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 70832589)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 67676153
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGTGGTTTTGAGCGACTTGCGAAGGGCCACGCAGTATGAGGTTCAAGTC[C/T]GAGCTCGGACATTCGCCGGATATGGAAGCTTTGGTAAAGCCATCCTCTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30869
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059042 Nonsense 863 989 15 18
ENSDART00000121947 Nonsense 863 987 15 17
ENSDART00000133074 Nonsense 836 960 14 16

The following transcripts of ENSDARG00000040346 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 70851664)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 67657078
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCGCCGCCGGACTGTCCCACATACTTGCACCAGCTGATGCTGGACTGCTG[G/A]CAGAAGGAGAGGACGGCCCGGCCACGCTTCGCCAACATCGTCTCAGCTCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link