mat2a

Ensembl ID:
ENSDARG00000040334
ZFIN ID:
ZDB-GENE-030131-2049
Description:
methionine adenosyltransferase II, alpha [Source:RefSeq peptide;Acc:NP_997802]
Human Orthologue:
MAT2A
Human Description:
methionine adenosyltransferase II, alpha [Source:HGNC Symbol;Acc:6904]
Mouse Orthologue:
Mat2a
Mouse Description:
methionine adenosyltransferase II, alpha Gene [Source:MGI Symbol;Acc:MGI:2443731]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14309 Nonsense Available for shipment Available now
sa16647 Essential Splice Site Available for shipment Available now
sa34836 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa14309
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112201 Nonsense 4 309 1 8
ENSDART00000121531 Nonsense 4 395 1 9

The following transcripts of ENSDARG00000040334 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 6849894)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 7862694
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATTAGAAACAGATTTAGAAGAGCGTAACAATACAATCAATATGAACGGA[C/T]AACTGAACGGCTTTCACAACTCYCTGATTGATGAAGACTGYTTTTTGTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16647
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112201 Essential Splice Site 30 309 1 8
ENSDART00000121531 Essential Splice Site 30 395 1 9

The following transcripts of ENSDARG00000040334 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 6849812)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 7862612
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAAGACTGYTTTTTGTTCACGTCGGAGTCTGTCGGCGAAGGACAYCCTG[G/A]TATGTATCATAACACANNNTATATTTAAAGGTTTTTTTTNNATTTTACAAGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34836
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112201 Nonsense 48 309 2 8
ENSDART00000121531 Nonsense 48 395 2 9

The following transcripts of ENSDARG00000040334 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 6843821)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 7856621
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAAGATTTGTGACCAGATCAGTGACGCTGTGTTGGACGCCCACCTCAAA[C/T]AGGATCCTGATGCCAAAGTAGCATGTGGTGAGTGTCAAATTATGCTTTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link