mat2a

Ensembl ID:
ENSDARG00000040334
ZFIN ID:
ZDB-GENE-030131-2049
Description:
methionine adenosyltransferase II, alpha [Source:RefSeq peptide;Acc:NP_997802]
Human Orthologue:
MAT2A
Human Description:
methionine adenosyltransferase II, alpha [Source:HGNC Symbol;Acc:6904]
Mouse Orthologue:
Mat2a
Mouse Description:
methionine adenosyltransferase II, alpha Gene [Source:MGI Symbol;Acc:MGI:2443731]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14309 Nonsense Available for shipment Available now
sa16647 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa14309
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112201 Nonsense 4 309 1 8
ENSDART00000121531 Nonsense 4 395 1 9

The following transcripts of ENSDARG00000040334 do not overlap with this mutation:

Genomic Location:
Chromosome 10 (position 6849894)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATTAGAAACAGATTTAGAAGAGCGTAACAATACAATCAATATGAACGGA[C/T]AACTGAACGGCTTTCACAACTCYCTGATTGATGAAGACTGYTTTTTGTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16647
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112201 Essential Splice Site 30 309 1 8
ENSDART00000121531 Essential Splice Site 30 395 1 9

The following transcripts of ENSDARG00000040334 do not overlap with this mutation:

Genomic Location:
Chromosome 10 (position 6849812)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAAGACTGYTTTTTGTTCACGTCGGAGTCTGTCGGCGAAGGACAYCCTG[G/A]TATGTATCATAACACANNNTATATTTAAAGGTTTTTTTTNNATTTTACAAGGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/p4ffi50r