Q568U1_DANRE

Ensembl ID:
ENSDARG00000040326
Description:
LOC553505 protein [Source:UniProtKB/TrEMBL;Acc:Q568U1]
Human Orthologue:
DHX29
Human Description:
DEAH (Asp-Glu-Ala-His) box polypeptide 29 [Source:HGNC Symbol;Acc:15815]
Mouse Orthologue:
Dhx29
Mouse Description:
DEAH (Asp-Glu-Ala-His) box polypeptide 29 Gene [Source:MGI Symbol;Acc:MGI:2145374]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15603 Nonsense Available for shipment Available now
sa21657 Nonsense Available for shipment Available now
sa34841 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa15603
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123923   None 307 None 9
ENSDART00000129467 Nonsense 439 1381 10 27
Genomic Location (Zv9):
Chromosome 10 (position 7211556)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 8229802
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGTTTTGGAGGTTTGTCCCACTATCCTGACTGAAGACGGCATGCAGGCY[C/T]AGCATTTAGGAGCCACRCTAGCACTTTATAACCTAGTCAAAGGRMAGGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21657
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123923   None 307 None 9
ENSDART00000129467 Nonsense 490 1381 11 27
Genomic Location (Zv9):
Chromosome 10 (position 7208155)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 8226401
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGGCGAACAAAAAGAAGAGGAACAAACTCTTTTGGCCATCAACAAACCC[C/T]GAGACCAGTTCATCTCACGTCTGCTCACTCGCCTCAAACAGCAGCAGAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34841
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123923   None 307 None 9
ENSDART00000129467 Essential Splice Site 1288 1381 24 27
Genomic Location (Zv9):
Chromosome 10 (position 7183820)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 8202066
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGTAAACCGTTTCCTGCAAACCCATGGCTGGATGCTTTTCCAGGAAAAAG[T/A]GAGCCAGGCTGTTTTTAATATGTTACTGGGACATGCTGTGGGGGGTTTTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link