rx2

Ensembl ID:
ENSDARG00000040321
ZFIN IDs:
ZDB-GENE-990415-237, ZDB-GENE-990415-237
Description:
Retinal homeobox protein Rx2 [Source:UniProtKB/Swiss-Prot;Acc:O42357]
Human Orthologues:
RAX, RAX2
Human Descriptions:
retina and anterior neural fold homeobox 2 [Source:HGNC Symbol;Acc:18286]
retina and anterior neural fold homeobox [Source:HGNC Symbol;Acc:18662]
Mouse Orthologue:
Rax
Mouse Description:
retina and anterior neural fold homeobox Gene [Source:MGI Symbol;Acc:MGI:109632]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa31303 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa31303
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059003 Nonsense 178 327 3 4
ENSDART00000122576 Nonsense 178 327 2 3
Genomic Location (Zv9):
Chromosome 2 (position 56051724)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 55714792
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGTGTACAGTCGAGAAGAGCTGGCCATGAAAGTCAACCTGCCTGAAGTT[C/T]GAGTTCAGGTGAGCGCCGGGACACTTAATGGAATTAAAGAGAGCGTGGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link