prpf4b

Ensembl ID:
ENSDARG00000040310
ZFIN ID:
ZDB-GENE-040426-2799
Description:
serine/threonine-protein kinase PRP4 homolog [Source:RefSeq peptide;Acc:NP_998614]
Human Orthologue:
PRPF4B
Human Description:
PRP4 pre-mRNA processing factor 4 homolog B (yeast) [Source:HGNC Symbol;Acc:17346]
Mouse Orthologue:
Prpf4b
Mouse Description:
PRP4 pre-mRNA processing factor 4 homolog B (yeast) Gene [Source:MGI Symbol;Acc:MGI:109584]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6760 Essential Splice Site Mutation detected in F1 DNA During 2017
sa44101 Nonsense Mutation detected in F1 DNA During 2017
sa37836 Nonsense Available for shipment Available now
sa44100 Essential Splice Site Mutation detected in F1 DNA During 2017
sa44099 Essential Splice Site Mutation detected in F1 DNA During 2017
sa30054 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa6760
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106310 Essential Splice Site 16 1010 None 15
ENSDART00000140217 Essential Splice Site 16 1010 None 15
Genomic Location (Zv9):
Chromosome 24 (position 11278131)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 11365534
KASP Assay ID:
554-5176.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAATGGCYGAWCTGGAAATGGATTTACAGAGTAAGCGACTGAATAACGGG[T/A]AAGAACACGTGCGTGGTGTAACACCAGCAATAAAGCATTTTAAAGTCTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44101
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106310 Nonsense 209 1010 2 15
ENSDART00000140217 Nonsense 209 1010 2 15
Genomic Location (Zv9):
Chromosome 24 (position 11269415)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 11356818
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAGAACACGTTCACCTAGGGACCAGATTGGTGGAATGGGTAGATCCAGA[C/T]GAGACTTGGACACCAGCAAACCAAGTGCTAAACAGCAAAGTCACAGTCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37836
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106310 Nonsense 238 1010 2 15
ENSDART00000140217 Nonsense 238 1010 2 15
Genomic Location (Zv9):
Chromosome 24 (position 11269328)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 11356731
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAGTCACAGTCATTCTCGAGAGAGAGCAGGAAGGGATTCAAAGCTTGAA[C/T]GAGCAACAAAAAGTGCAAAAGAGACTGTTAAAGAGCGCAGCAAGTCCAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44100
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106310 Essential Splice Site 553 1010 5 15
ENSDART00000140217 Essential Splice Site 553 1010 5 15
Genomic Location (Zv9):
Chromosome 24 (position 11259433)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 11346836
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGAGGCTCTGATTGAGCAGAGACGACAGCAGCGGCTGGCTATTGTACAG[G/A]TAGTTCATTACATCCGTACTCATGAGACACACAAGCTTTCTTTTTTTTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44099
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106310 Essential Splice Site 679 1010 8 15
ENSDART00000140217 Essential Splice Site 679 1010 8 15
Genomic Location (Zv9):
Chromosome 24 (position 11255985)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 11343388
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGAACCCCAACCTCAGGGACAATTGGACTGATGCAGAAGGATACTACCG[T/G]AAGTCCAAAGCTATGTTTTTTTGCAAAACCGAACGAGTTGAAATATGTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30054
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106310 Nonsense 883 1010 13 15
ENSDART00000140217 Nonsense 883 1010 13 15
Genomic Location (Zv9):
Chromosome 24 (position 11246945)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 11334348
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAACCATATGATTATGGTATTGATATGTGGTCAGTTGGCTGTACCTTGTA[T/A]GAGCTATACACAGGAAAAATTCTCTTCCCTGGCTCCTCCAACAACCACAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link