otomp

Ensembl ID:
ENSDARG00000040306
ZFIN ID:
ZDB-GENE-040709-1
Description:
Otolith matrix protein 1 [Source:UniProtKB/Swiss-Prot;Acc:Q0VIL3]
Human Orthologue:
MFI2
Human Description:
antigen p97 (melanoma associated) identified by monoclonal antibodies 133.2 and 96.5 [Source:HGNC Sy
Mouse Orthologue:
Mfi2
Mouse Description:
antigen p97 (melanoma associated) identified by monoclonal antibodies 133.2 and 96.5 Gene [Source:MG

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19833 Nonsense Available for shipment Available now
sa6858 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa19833
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126794 Nonsense 201 401 5 9
ENSDART00000130830 Nonsense 201 401 5 9

The following transcripts of ENSDARG00000040306 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 41593260)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 41665058
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGAAGCCGCTTAAATAGTCATCTGCTTCTCCTTGTGATTCATAGCGGTC[G/T]GAGATTTCTTTGGCTACAGCTGCGTCCCTGGCGTGAAGGACCCAGAACAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6858
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126794 Essential Splice Site 280 401 6 9
ENSDART00000130830 Essential Splice Site 280 401 6 9

The following transcripts of ENSDARG00000040306 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 41595107)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 41663211
KASP Assay ID:
554-5349.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCGATGTTGCTTTTGTTAAGCACACTACAGTCTTTGACAACATGCAGGG[T/A]AAGTAGTGCAGGCTATAAGAACATGAGAGGTCAAAAACGTCCCGAWGCAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link