gtpbp10

Ensembl ID:
ENSDARG00000040300
ZFIN ID:
ZDB-GENE-040718-153
Description:
GTP-binding protein 10 [Source:UniProtKB/Swiss-Prot;Acc:Q6DHF7]
Human Orthologue:
GTPBP10
Human Description:
GTP-binding protein 10 (putative) [Source:HGNC Symbol;Acc:25106]
Mouse Orthologue:
Gtpbp10
Mouse Description:
GTP-binding protein 10 (putative) Gene [Source:MGI Symbol;Acc:MGI:2385599]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36116 Nonsense Mutation detected in F1 DNA During 2017
sa36117 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa36116
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058970 Nonsense 264 380 9 10
ENSDART00000122581 Nonsense 264 380 9 11
Genomic Location (Zv9):
Chromosome 16 (position 26140115)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 23985790
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTGTATACTTCCTCATGGCCTTCTTTGTTAAACAGGAGCTGGAGTTGTA[C/A]AAGGAGGAGCTGTTAAGCAAGCCTGCTATCTTGGTCATAAATAAAATGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36117
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058970 Nonsense 342 380 10 10
ENSDART00000122581 Nonsense 342 380 10 11
Genomic Location (Zv9):
Chromosome 16 (position 26140718)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 23986393
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCCATGACTGGTCATGGACTGCCCTTGCTCAAGTCCCTGATCCGGCAGT[C/A]GCTTGAGGAGCAGGACACCATAGACACTGAGGCTCAGCGCAGTCAGAAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link