apoa4

Ensembl ID:
ENSDARG00000040298
ZFIN ID:
ZDB-GENE-030131-1263
Description:
apolipoprotein A-IV [Source:RefSeq peptide;Acc:NP_001073330]
Human Orthologues:
APOA1, APOA4, APOA5
Human Descriptions:
apolipoprotein A-I [Source:HGNC Symbol;Acc:600]
apolipoprotein A-IV [Source:HGNC Symbol;Acc:602]
apolipoprotein A-V [Source:HGNC Symbol;Acc:17288]
Mouse Orthologues:
Apoa1, Apoa4, Apoa5
Mouse Descriptions:
apolipoprotein A-I Gene [Source:MGI Symbol;Acc:MGI:88049]
apolipoprotein A-IV Gene [Source:MGI Symbol;Acc:MGI:88051]
apolipoprotein A-V Gene [Source:MGI Symbol;Acc:MGI:1913363]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa4658 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa4658
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011669 Nonsense 83 239 3 3
ENSDART00000126607 Nonsense 81 368 3 6
ENSDART00000129525 Nonsense 83 255 4 4

The following transcripts of ENSDARG00000040298 do not overlap with this mutation:

Genomic Location:
Chromosome 16 (position 26154377)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACTGACCCAGAGTGCTGATATGGCCAGTGAATACGCCGTCACCCTCAAG[A/T]AACAGGTGGATCCTCTGACTGAAGAGCTGATGAACAAAATCACCAAGGAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/098k2yta