cadm4

Ensembl ID:
ENSDARG00000040291
ZFIN ID:
ZDB-GENE-041114-138
Description:
cell adhesion molecule 4 [Source:RefSeq peptide;Acc:NP_001007429]
Human Orthologue:
CADM4
Human Description:
cell adhesion molecule 4 [Source:HGNC Symbol;Acc:30825]
Mouse Orthologue:
Cadm4
Mouse Description:
cell adhesion molecule 4 Gene [Source:MGI Symbol;Acc:MGI:2449088]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12426 Nonsense Available for shipment Available now
sa7788 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa12426
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058960 Nonsense 50 367 1 7
ENSDART00000111564 Nonsense 76 415 2 9
ENSDART00000134120 Nonsense 74 413 2 9
ENSDART00000143761 Nonsense 74 391 2 8

The following transcripts of ENSDARG00000040291 do not overlap with this mutation:

Genomic Location:
Chromosome 16 (position 26541348)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCGTGGTCATCCAGAACCCACGCAGACAGACGCTCTTCTTTAATGGAACA[C/T]GAGRTGAGAACTGCCACTGCTAGGATGATAATTGCTAGTCGGTCTTTTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7788
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058960 Essential Splice Site 50 367 1 7
ENSDART00000111564 Essential Splice Site 76 415 2 9
ENSDART00000134120 Essential Splice Site 74 413 2 9
ENSDART00000143761 Essential Splice Site 74 391 2 8

The following transcripts of ENSDARG00000040291 do not overlap with this mutation:

Genomic Location:
Chromosome 16 (position 26541344)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTCATCCAGAACCCACGCAGACAGACGCTCTTCTTTAATGGAACACGAG[G/A]TGAGAACTGCCACTGCTAGGATGATAATTGCTAGTCGGTCTTTTTAAAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/gt2vt3d2