cadm4

Ensembl ID:
ENSDARG00000040291
ZFIN ID:
ZDB-GENE-041114-138
Description:
cell adhesion molecule 4 [Source:RefSeq peptide;Acc:NP_001007429]
Human Orthologue:
CADM4
Human Description:
cell adhesion molecule 4 [Source:HGNC Symbol;Acc:30825]
Mouse Orthologue:
Cadm4
Mouse Description:
cell adhesion molecule 4 Gene [Source:MGI Symbol;Acc:MGI:2449088]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12426 Nonsense Available for shipment Available now
sa7788 Essential Splice Site Mutation detected in F1 DNA During 2016
sa36121 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa12426
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058960 Nonsense 50 367 1 7
ENSDART00000111564 Nonsense 76 415 2 9
ENSDART00000134120 Nonsense 74 413 2 9
ENSDART00000143761 Nonsense 74 391 2 8

The following transcripts of ENSDARG00000040291 do not overlap with this mutation:

Genomic Location:
Chromosome 16 (position 26541348)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCGTGGTCATCCAGAACCCACGCAGACAGACGCTCTTCTTTAATGGAACA[C/T]GAGRTGAGAACTGCCACTGCTAGGATGATAATTGCTAGTCGGTCTTTTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7788
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058960 Essential Splice Site 50 367 1 7
ENSDART00000111564 Essential Splice Site 76 415 2 9
ENSDART00000134120 Essential Splice Site 74 413 2 9
ENSDART00000143761 Essential Splice Site 74 391 2 8

The following transcripts of ENSDARG00000040291 do not overlap with this mutation:

Genomic Location:
Chromosome 16 (position 26541344)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTCATCCAGAACCCACGCAGACAGACGCTCTTCTTTAATGGAACACGAG[G/A]TGAGAACTGCCACTGCTAGGATGATAATTGCTAGTCGGTCTTTTTAAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36121
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058960 Nonsense 239 367 5 7
ENSDART00000111564 Nonsense 265 415 6 9
ENSDART00000134120 Nonsense 263 413 6 9
ENSDART00000143761 Nonsense 263 391 6 8

The following transcripts of ENSDARG00000040291 do not overlap with this mutation:

Genomic Location:
Chromosome 16 (position 26492565)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAATGTCATCTTCCACTTCCTTTCTAGACCACGTGACATCCAGTGGTCA[C/T]GAGTGAACGACACTCTTCCTGAGAGGGCGGAGAAAACCGGCAACATCCTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link