ywhabl

Ensembl ID:
ENSDARG00000040287
ZFIN ID:
ZDB-GENE-030131-448
Description:
tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, beta polypeptide like [Sour
Human Orthologues:
YWHAB, YWHAQ, YWHAZ
Human Descriptions:
tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, beta polypeptide [Source:HGN
tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, theta polypeptide [Source:HG
tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide [Source:HGN
Mouse Orthologues:
Ywhab, Ywhaq, Ywhaz
Mouse Descriptions:
tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, beta polypeptide Gene [Sourc
tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, theta polypeptide Gene [Sour
tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide Gene [Sourc

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa6430 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa6430
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058956 Essential Splice Site 187 238 3 5
ENSDART00000114304 Essential Splice Site 194 245 4 6
Genomic Location:
Chromosome 16 (position 26932010)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTACGAGATTCTCAACTCRCCCGAACAGGCCTGCAAGCTCGCCAAAACAG[T/C]AAGTTTAACAGATTAACAGACWCCCACACAAGCTAATCAACAAACTATGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/b7dkvhxn