LOC563341

Ensembl ID:
ENSDARG00000040278
Human Orthologue:
KLHL38
Human Description:
kelch-like 38 (Drosophila) [Source:HGNC Symbol;Acc:34435]
Mouse Orthologue:
Klhl38
Mouse Description:
kelch-like 38 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:3045310]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7424 Missense Mutation detected in F1 DNA During 2014
sa9558 Nonsense Available for shipment Available now
hu7869 Nonsense Available for shipment Available now
sa16914 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa7424
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > G
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058941 Missense 10 595 1 4
Genomic Location:
Chromosome 16 (position 27485616)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAGTTTTCTGTTTGCTTGTCATTATATGTCAGNNNTCAAGAAATTGGAA[A/G]AAATCTGAGATAAATGTGWTTGTGGTGAACTTGCAGAATTGTTAAATAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9558
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058941 Nonsense 244 595 2 4
Genomic Location:
Chromosome 16 (position 27487225)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATACACGATTTGTTCCRTCGYGTGAGACTGAGACACGTCCACCCTTATTA[T/A]CTTTTCCAGTTCATTGCCAATGACCCTCTAGTTCAGTCRTCATCTTTATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
hu7869
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058941 Nonsense 327 595 2 4
Genomic Location:
Chromosome 16 (position 27487473)
KASP Assay ID:
554-2380.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACATCCCGTGAGGCGCTACTCTATGATGAACAATCTCACTGTTGGAAAT[G/A]GCTTGCAAAGATTCCTCTTCGGCTCTACAGGCCTGCTTATGTCTGCATGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16914
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058941 Nonsense 387 595 2 4
Genomic Location:
Chromosome 16 (position 27487652)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTCTCTAAAAACAAATCAGTGGCGAATGGGAGAATCCATGCTGACGTCC[C/T]GATACGGCCATCAGARCGCCACCTACCTGCATTTTATTTTTGTTCTGGGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/iot9z9on