fbxo32

Ensembl ID:
ENSDARG00000040277
ZFIN ID:
ZDB-GENE-040426-1040
Description:
F-box only protein 32 [Source:RefSeq peptide;Acc:NP_957211]
Human Orthologue:
FBXO32
Human Description:
F-box protein 32 [Source:HGNC Symbol;Acc:16731]
Mouse Orthologue:
Fbxo32
Mouse Description:
F-box protein 32 Gene [Source:MGI Symbol;Acc:MGI:1914981]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9611 Nonsense Available for shipment Available now
sa8703 Essential Splice Site Mutation detected in F1 DNA During 2014
sa6431 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa9611
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058938 Nonsense 80 356 3 9

The following transcripts of ENSDARG00000040277 do not overlap with this mutation:

Genomic Location:
Chromosome 16 (position 27499665)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTGTCTACTAGTGTAAAAACTTAACTGACTGCTTTGTTTCAGATTTTTA[T/G]AAAGACAAATGGATTTATGTCCATAAAGGGAGCACCAAAGAGGTAAGATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8703
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058938 Essential Splice Site 125 356 4 9

The following transcripts of ENSDARG00000040277 do not overlap with this mutation:

Genomic Location:
Chromosome 16 (position 27499882)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTCTGCAGTGCCATCAAGGACACCAGGCGATTTAATTATGTCGTAAGGG[T/G]GAGTTTCCACTGTCTGTTTATAGCTAGGTGAATGGTGACTWTAGCCAGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6431
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058938 Nonsense 294 356 8 9

The following transcripts of ENSDARG00000040277 do not overlap with this mutation:

Genomic Location:
Chromosome 16 (position 27511077)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCACAGATCCGCAAGCGCCTCATGGTTTCAGATAAAGGGCAGTTGGAAT[G/A]GAAAAAGATGTATTTTAAGCTGTGTCGGTGTTACCCTCACAAAGAGCAGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/hach8dtp