mpdu1b

Ensembl ID:
ENSDARG00000040265
ZFIN ID:
ZDB-GENE-040625-135
Description:
mannose-P-dolichol utilization defect 1 protein [Source:RefSeq peptide;Acc:NP_001002130]
Human Orthologue:
MPDU1
Human Description:
mannose-P-dolichol utilization defect 1 [Source:HGNC Symbol;Acc:7207]
Mouse Orthologue:
Mpdu1
Mouse Description:
mannose-P-dolichol utilization defect 1 Gene [Source:MGI Symbol;Acc:MGI:1346040]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa944 Nonsense F2 line generated During 2014

Mutation Details

Allele Name:
sa944
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058908 Nonsense 112 255 4 7

The following transcripts of ENSDARG00000040265 do not overlap with this mutation:

Genomic Location:
Chromosome 7 (position 27594580)
KASP Assay ID:
554-0849.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGTATACAGTAATAATACGACCGGGATTATTTCTGACAGTTCCTGGGGT[G/T]AGGCACTTTTCCTCATGTTTCAGACTGTGACCATTGGTTTCCTCATACAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • IgA nephropathy: A genome-wide association study in Han Chinese identifies multiple susceptibility loci for IgA nephropathy. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/6pdvxijw