runx2a

Ensembl ID:
ENSDARG00000040261
ZFIN ID:
ZDB-GENE-040629-3
Description:
runt-related transcription factor 2 [Source:RefSeq peptide;Acc:NP_998023]
Human Orthologue:
RUNX2
Human Description:
runt-related transcription factor 2 [Source:HGNC Symbol;Acc:10472]
Mouse Orthologue:
Runx2
Mouse Description:
runt related transcription factor 2 Gene [Source:MGI Symbol;Acc:MGI:99829]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13625 Nonsense Available for shipment Available now
sa2928 Essential Splice Site F2 line generated During 2014

Mutation Details

Allele Name:
sa13625
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081849 None None 203 None 5
ENSDART00000081854 None None 57 None 4
ENSDART00000105394 Nonsense 192 467 5 7
ENSDART00000131430 Nonsense 178 453 4 6
Genomic Location:
Chromosome 17 (position 5222718)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGGAGGGGTGTTAAYTGCAATCTCTGTCTAATATTRTTCGTTAGGACAC[A/T]GACAGAAACTGGAAGACCCCCCTAAACCGCCGCTGTTCTCCGAGCGCCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2928
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081849 None None 203 None 5
ENSDART00000081854 None None 57 None 4
ENSDART00000105394 Essential Splice Site 303 467 6 7
ENSDART00000131430 Essential Splice Site 289 453 5 6
Genomic Location:
Chromosome 17 (position 5227964)
KASP Assay ID:
554-3337.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGTGCCACCGGCCTGCCCACCATCAGCGACGTGCCACGACGCCTCTCAGG[T/C]ACTCACACCTGCAGAAACCACACAAATTAGGGTACGCTCACACTACRCTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/tmqfqfi5