ephx2

Ensembl ID:
ENSDARG00000040255
ZFIN ID:
ZDB-GENE-041212-70
Description:
epoxide hydrolase 2 [Source:RefSeq peptide;Acc:NP_001008642]
Human Orthologue:
EPHX2
Human Description:
epoxide hydrolase 2, cytoplasmic [Source:HGNC Symbol;Acc:3402]
Mouse Orthologue:
Ephx2
Mouse Description:
epoxide hydrolase 2, cytoplasmic Gene [Source:MGI Symbol;Acc:MGI:99500]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14928 Nonsense Available for shipment Available now
sa6457 Essential Splice Site Mutation detected in F1 DNA During 2015
sa28783 Nonsense Mutation detected in F1 DNA During 2015

Mutation Details

Allele Name:
sa14928
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058890 Nonsense 272 557 8 20
Genomic Location:
Chromosome 17 (position 5828862)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTGTTCTCCTGTGTCATGGATTCCCTGAGAGCTGGTTTTCCWGGAGGTA[T/A]CAGGTGAGAAAYATMAAACTTTAYAGCTGATGTAACTGAAACGCAGACCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6457
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058890 Essential Splice Site 425 557 15 20
Genomic Location:
Chromosome 17 (position 5802363)
KASP Assay ID:
554-5381.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTGCAGGATGGATTTCCTAAGTTATCCCCTGCTGGAGTTTGTCAGAGAG[G/A]TAAATACATCAAACNNNNNNATTTTCAGTTTTTGATTTGTCTGCATCTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28783
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058890 Nonsense 454 557 16 20
Genomic Location:
Chromosome 17 (position 5802143)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGCAGCTCCATGCTGAGTGTGTCTGCGCTTCAGTTTTACACAGAGCAGTA[C/A]AGCAAGAGCGGATTCAGGTACACCGAGAACATGAGCTCCTCGATCTGTGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/7qdnjhbt