ephx2

Ensembl ID:
ENSDARG00000040255
ZFIN ID:
ZDB-GENE-041212-70
Description:
epoxide hydrolase 2 [Source:RefSeq peptide;Acc:NP_001008642]
Human Orthologue:
EPHX2
Human Description:
epoxide hydrolase 2, cytoplasmic [Source:HGNC Symbol;Acc:3402]
Mouse Orthologue:
Ephx2
Mouse Description:
epoxide hydrolase 2, cytoplasmic Gene [Source:MGI Symbol;Acc:MGI:99500]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14928 Nonsense Available for shipment Available now
sa6457 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa14928
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058890 Nonsense 272 557 8 20
Genomic Location:
Chromosome 17 (position 5828862)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTGTTCTCCTGTGTCATGGATTCCCTGAGAGCTGGTTTTCCWGGAGGTA[T/A]CAGGTGAGAAAYATMAAACTTTAYAGCTGATGTAACTGAAACGCAGACCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6457
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058890 Essential Splice Site 425 557 15 20
Genomic Location:
Chromosome 17 (position 5802363)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTGCAGGATGGATTTCCTAAGTTATCCCCTGCTGGAGTTTGTCAGAGAG[G/A]TAAATACATCAAACNNNNNNATTTTCAGTTTTTGATTTGTCTGCATCTTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/7qdnjhbt