hormad1

Ensembl ID:
ENSDARG00000040254
ZFIN ID:
ZDB-GENE-040718-49
Description:
HORMA domain-containing protein 1 [Source:UniProtKB/Swiss-Prot;Acc:A2BF66]
Human Orthologue:
HORMAD1
Human Description:
HORMA domain containing 1 [Source:HGNC Symbol;Acc:25245]
Mouse Orthologue:
Hormad1
Mouse Description:
HORMA domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1915231]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14324 Nonsense Available for shipment Available now
sa12124 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa14324
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058888 Nonsense 81 356 5 15
Genomic Location:
Chromosome 16 (position 31816134)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTGTAAAGGCTGTAAGCTACATAATGASWAYCTCACCTTCTCTTYAGGT[T/A]GCAGGGATGTTTTGATGCACTTCAAAGAAGATATGTAAGTCTGCATTTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12124
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058888 Essential Splice Site 303 356 13 15
Genomic Location:
Chromosome 16 (position 31812525)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAGCAGCCTCACAGACACACCAAGGAGGAWTTTTCAACAAATCCAAAGG[T/C]AGCACTGCACCACAAATGTGATGTATCAGTCTGCTCCAGAAYTTGTGTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/o5ghzibz