tlr18

Ensembl ID:
ENSDARG00000040249
ZFIN ID:
ZDB-GENE-040220-2
Description:
toll-like receptor 18 [Source:RefSeq peptide;Acc:NP_001082819]
Human Orthologue:
TLR2
Human Description:
toll-like receptor 2 [Source:HGNC Symbol;Acc:11848]
Mouse Orthologue:
Tlr2
Mouse Description:
toll-like receptor 2 Gene [Source:MGI Symbol;Acc:MGI:1346060]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7794 Nonsense Mutation detected in F1 DNA During 2014
sa471 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa7794
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130757 Nonsense 191 854 2 4
Genomic Location:
Chromosome 16 (position 31657114)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTTCATTAGACAAGTTTGCAGTAAAAACAGGCACTGGATTTAGGGATTA[T/A]GAACCGGGGTATTTCAAAAGCCTCAGCACAAAACACTTGTGGTTTGATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa471
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130757 Nonsense 443 854 3 4
Genomic Location:
Chromosome 16 (position 31655147)
KASP Assay ID:
554-0203.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCTGCAATACCTGGGCAACGGTGCCTGTGACTGGAGAAAAACCATTACT[A/T]AAGTGATCGGTAATCACAATAGTTTAACAAGCGACAGTTTTAAGTGCCTC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/maigjgxu