tlr18

Ensembl ID:
ENSDARG00000040249
ZFIN ID:
ZDB-GENE-040220-2
Description:
toll-like receptor 18 [Source:RefSeq peptide;Acc:NP_001082819]
Human Orthologue:
TLR2
Human Description:
toll-like receptor 2 [Source:HGNC Symbol;Acc:11848]
Mouse Orthologue:
Tlr2
Mouse Description:
toll-like receptor 2 Gene [Source:MGI Symbol;Acc:MGI:1346060]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7794 Nonsense Mutation detected in F1 DNA During 2016
sa471 Nonsense Available for shipment Available now
sa36169 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa7794
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130757 Nonsense 191 854 2 4
Genomic Location:
Chromosome 16 (position 31657114)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTTCATTAGACAAGTTTGCAGTAAAAACAGGCACTGGATTTAGGGATTA[T/A]GAACCGGGGTATTTCAAAAGCCTCAGCACAAAACACTTGTGGTTTGATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa471
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130757 Nonsense 443 854 3 4
Genomic Location:
Chromosome 16 (position 31655147)
KASP Assay ID:
554-0203.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCTGCAATACCTGGGCAACGGTGCCTGTGACTGGAGAAAAACCATTACT[A/T]AAGTGATCGGTAATCACAATAGTTTAACAAGCGACAGTTTTAAGTGCCTC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa36169
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130757 Nonsense 507 854 3 4
Genomic Location:
Chromosome 16 (position 31654955)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCTTCTTAGCGGAAACAAGATCAAATTCATCCCATCAGGATGGAAGAAT[C/T]GATATTTGAGGACGCTAGCTTTAGATGGAAACTCATTTGGACTTGTTAGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link