si:dkey-181l4.3

Ensembl ID:
ENSDARG00000040247
ZFIN ID:
ZDB-GENE-090312-23
Description:
similar to G protein-coupled receptor 80 [Source:RefSeq peptide;Acc:NP_001139100]
Human Orthologue:
OXGR1
Human Description:
oxoglutarate (alpha-ketoglutarate) receptor 1 [Source:HGNC Symbol;Acc:4531]
Mouse Orthologue:
Oxgr1
Mouse Description:
oxoglutarate (alpha-ketoglutarate) receptor 1 Gene [Source:MGI Symbol;Acc:MGI:2685145]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1999 Nonsense F2 line generated During 2017
sa5655 Nonsense F2 line generated During 2017

Mutation Details

Allele Name:
sa1999
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058878 Nonsense 314 329 1 1
ENSDART00000058878 Nonsense 314 329 1 1
Genomic Location (Zv9):
Chromosome 1 (position 1817266)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 1912686
KASP Assay ID:
554-3149.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCAGGGCGGTAACTTTAAACAGGCTTTTGTGGAGCTCTTCAAATGTAAG[A/T]AACTCAAGTCGAAGACTGAAAGGACTGTTGAAATGGCGGTGATCAACTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5655
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058878 Nonsense 314 329 1 1
ENSDART00000058878 Nonsense 314 329 1 1
Genomic Location (Zv9):
Chromosome 1 (position 1817266)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 1912686
KASP Assay ID:
554-3149.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCAGGGCGGTAACTTTAAACAGGCTTTTGTGGAGCTCTTCAAATGTAAG[A/T]AACTCAAGTCGAAGACTGAAAGGACTGTTGAAATGGCGGTGATCAACTAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link