kpnb3

Ensembl ID:
ENSDARG00000040245
ZFIN ID:
ZDB-GENE-030424-2
Description:
importin-5 [Source:RefSeq peptide;Acc:NP_001139076]
Human Orthologues:
IPO5, RANBP6
Human Descriptions:
importin 5 [Source:HGNC Symbol;Acc:6402]
RAN binding protein 6 [Source:HGNC Symbol;Acc:9851]
Mouse Orthologues:
Ipo5, Ranbp6
Mouse Descriptions:
importin 5 Gene [Source:MGI Symbol;Acc:MGI:1917822]
RAN binding protein 6 Gene [Source:MGI Symbol;Acc:MGI:2683212]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa14722 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa14722
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058876 Essential Splice Site 53 1077 2 26

The following transcripts of ENSDARG00000040245 do not overlap with this mutation:

Genomic Location:
Chromosome 1 (position 2022010)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGATCACATTTTTACTGCAGGCCATCCGTGATGCATCCGCTGCCGAGGAG[G/T]TGCGTGAGAGTCTRTTTACTGTCTTCATTCCAGAYGTYCATTTAGACTCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/h8sxiw4e