tpbgl

Ensembl ID:
ENSDARG00000040216
ZFIN ID:
ZDB-GENE-030827-4
Description:
trophoblast glycoprotein-like [Source:RefSeq peptide;Acc:NP_919373]
Human Orthologue:
TPBG
Human Description:
trophoblast glycoprotein [Source:HGNC Symbol;Acc:12004]
Mouse Orthologue:
Tpbg
Mouse Description:
trophoblast glycoprotein Gene [Source:MGI Symbol;Acc:MGI:1341264]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23545 Nonsense Available for shipment Available now
sa18294 Nonsense Available for shipment Available now
sa7458 Missense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa23545
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058831 Nonsense 7 372 1 2
Genomic Location:
Chromosome 19 (position 30510716)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGTTGATGCTTTATTGCTGATATTTCACCATGTTTGCCCGTGGACGTTG[T/A]GCGGTTGTGTTGGGGCTGCTGTGTGCCGCCGCGGTCTCCGCTGGCGCATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18294
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058831 Nonsense 107 372 2 2
Genomic Location:
Chromosome 19 (position 30511914)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATCTCTGAGGTRAAGTCTCACACATTTTCCAGCTTGCGGAGCCTCAGAT[C/A]GCTGGACCTCAGCAACAACMAGYTGGCTGTCATCCATCCTGAGGCATTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7458
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058831 Missense 312 372 2 2
Genomic Location:
Chromosome 19 (position 30512529)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCAGGAGACAGCGACAACCTTGCGCTACAGACCTCTTACGWGTTCCTGG[G/A]TYTGGTGCTGGGATTTGTTGGTCTCATGTTTYTATTTGTCCTTTACCTGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/3znyo4lf