
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
tpbgl
- Ensembl ID:
- ENSDARG00000040216
- ZFIN ID:
- ZDB-GENE-030827-4
- Description:
- trophoblast glycoprotein-like [Source:RefSeq peptide;Acc:NP_919373]
- Human Orthologue:
- TPBG
- Human Description:
- trophoblast glycoprotein [Source:HGNC Symbol;Acc:12004]
- Mouse Orthologue:
- Tpbg
- Mouse Description:
- trophoblast glycoprotein Gene [Source:MGI Symbol;Acc:MGI:1341264]
Alleles
There are 3 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa23545 | Nonsense | Available for shipment | Available now |
sa18294 | Nonsense | Available for shipment | Available now |
sa7458 | Missense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa23545
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000058831 | Nonsense | 7 | 372 | 1 | 2 |
- Genomic Location (Zv9):
- Chromosome 19 (position 30510716)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 19 14197342 GRCz11 19 14059537 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AAGTTGATGCTTTATTGCTGATATTTCACCATGTTTGCCCGTGGACGTTG[T/A]GCGGTTGTGTTGGGGCTGCTGTGTGCCGCCGCGGTCTCCGCTGGCGCATT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa18294
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000058831 | Nonsense | 107 | 372 | 2 | 2 |
- Genomic Location (Zv9):
- Chromosome 19 (position 30511914)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 19 14198540 GRCz11 19 14060735 - KASP Assay ID:
- 2261-3417.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GATCTCTGAGGTRAAGTCTCACACATTTTCCAGCTTGCGGAGCCTCAGAT[C/A]GCTGGACCTCAGCAACAACMAGYTGGCTGTCATCCATCCTGAGGCATTCA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa7458
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Missense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000058831 | Missense | 312 | 372 | 2 | 2 |
- Genomic Location (Zv9):
- Chromosome 19 (position 30512529)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 19 14199155 GRCz11 19 14061350 - KASP Assay ID:
- 554-4239.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- AGCAGGAGACAGCGACAACCTTGCGCTACAGACCTCTTACGWGTTCCTGG[G/A]TYTGGTGCTGGGATTTGTTGGTCTCATGTTTYTATTTGTCCTTTACCTGA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: