scrt1b

Ensembl ID:
ENSDARG00000040214
ZFIN ID:
ZDB-GENE-050327-72
Description:
scratch homolog 1, zinc finger protein b [Source:RefSeq peptide;Acc:NP_001014369]
Human Orthologue:
SCRT1
Human Description:
scratch homolog 1, zinc finger protein (Drosophila) [Source:HGNC Symbol;Acc:15950]
Mouse Orthologue:
Scrt1
Mouse Description:
scratch homolog 1, zinc finger protein (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2176606]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa36177 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa36177
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058829 Nonsense 64 279 2 2
Genomic Location (Zv9):
Chromosome 16 (position 33491500)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 31229400
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGGCCATTTATGATGGAGAGAGTGACGGAGGCACTAAAGTACCTTCTCCA[G/T]GACCTATTTACGACAGCAACCACAGTGACTACGGGGCACCTGACTCAGAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link