fstl5

Ensembl ID:
ENSDARG00000040198
ZFIN ID:
ZDB-GENE-070127-1
Description:
follistatin-related protein 5 [Source:RefSeq peptide;Acc:NP_001027012]
Human Orthologue:
FSTL5
Human Description:
follistatin-like 5 [Source:HGNC Symbol;Acc:21386]
Mouse Orthologue:
Fstl5
Mouse Description:
follistatin-like 5 Gene [Source:MGI Symbol;Acc:MGI:2442179]

Alleles

There are 8 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7399 Missense Mutation detected in F1 DNA During 2014
sa12250 Nonsense Available for shipment Available now
sa3891 Nonsense Mutation detected in F1 DNA During 2014
sa22551 Nonsense Mutation detected in F1 DNA During 2014
sa1377 Nonsense Available for shipment Available now
sa11024 Nonsense Available for shipment Available now
sa19099 Nonsense Mutation detected in F1 DNA During 2014
sa22550 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa7399
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058796 Missense 147 854 5 16
ENSDART00000135479 None None 234 None 1
Genomic Location:
Chromosome 14 (position 50077721)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATACACAGAACTGACYAGCGTTTCTCTTCCACTCTTCACAGATGATAAC[T/C]GCCGYCTGGGAGATTAYAAAAAATTGAAGAGCAAGATGTTGGACATACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12250
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058796 Nonsense 192 854 5 16
ENSDART00000135479 None None 234 None 1
Genomic Location:
Chromosome 14 (position 50077586)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCCACGAGAAGGATATGGCCGCTAGGAAGCATCTGGTGGACATGATGTTT[A/T]AGCGATTTGACGCAGACGGCAATGGAAAAGTTGACAGCAGCGAGCTTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3891
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058796 Nonsense 253 854 7 16
ENSDART00000135479 None None 234 None 1
Genomic Location:
Chromosome 14 (position 50031937)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAAAGCTAATCATCAAGCCTTGTGTGTTTTGTTGTCCTCAGAGGTGTAC[C/T]AGCTCAGCCTTCCAGAAGAGCAGAAGCTGAGCGTCACCACGGTAACAGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22551
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058796 Nonsense 399 854 9 16
ENSDART00000135479 None None 234 None 1
Genomic Location:
Chromosome 14 (position 50009830)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAAGAACGGCATGGACATCACCACTAAACTCTCCAAACAGCTCACACTT[C/T]AAGGTACAAACACATCACCTGACGACACTATATATAAAAATACACTTCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1377
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058796 Nonsense 784 854 16 16
ENSDART00000135479 Nonsense 164 234 1 1
Genomic Location:
Chromosome 14 (position 49940216)
KASP Assay ID:
554-1289.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCGGCAGGCAGACGGATGCTCTTTTTGTGGAGCTCAGTTCTGGCAGTGTC[A/T]AAATGATCAAGAGCTTGAAGCAGCCCACGGCGTCGGCGCAGTGGCCCTGG
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa11024
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058796 Nonsense 822 854 16 16
ENSDART00000135479 Nonsense 202 234 1 1
ENSDART00000058796 Nonsense 822 854 16 16
ENSDART00000135479 Nonsense 202 234 1 1
Genomic Location:
Chromosome 14 (position 49940102)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGTTATGACCGGAAGCGGGCTGTTCGGACAGTATCTCATGACCCCGTCA[C/T]AAAGCTCCCTGTTTATACTGGATGGGCGTCTGGAWAAACTCAACTGTGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19099
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058796 Nonsense 822 854 16 16
ENSDART00000135479 Nonsense 202 234 1 1
ENSDART00000058796 Nonsense 822 854 16 16
ENSDART00000135479 Nonsense 202 234 1 1
Genomic Location:
Chromosome 14 (position 49940102)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGTTATGACCGGAAGCGGGCTGTTCGGACAGTATCTCATGACCCCGTCA[C/T]AAAGCTCCCTGTTTATACTGGATGGGCGTCTGGATAAACTCAACTGTGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22550
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058796 Nonsense 844 854 16 16
ENSDART00000135479 Nonsense 224 234 1 1
Genomic Location:
Chromosome 14 (position 49940035)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTGGATGGGCGTCTGGATAAACTCAACTGTGAGATCACCGACGTTCCCT[T/A]GGGAAATACTGTGGTGTGGGTGGGAGAGGCGTAAGACGTCTTAAAAAGGG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Weight: Genome-wide association study of anthropometric traits and evidence of interactions with age and study year in Filipino women. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/cbyu1sj8