nenf

Ensembl ID:
ENSDARG00000040192
ZFIN ID:
ZDB-GENE-050320-129
Description:
neudesin [Source:RefSeq peptide;Acc:NP_001032793]
Human Orthologue:
NENF
Human Description:
neuron derived neurotrophic factor [Source:HGNC Symbol;Acc:30384]
Mouse Orthologue:
Nenf
Mouse Description:
neuron derived neurotrophic factor Gene [Source:MGI Symbol;Acc:MGI:1913458]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa36515 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa36515
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058793 Nonsense 46 188 1 4

The following transcripts of ENSDARG00000040192 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 17 (position 45563718)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 45412950
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAATGTTTTATTGGCGTAGTGTTTTAATATACGCGTTATTAAATGTTTG[T/A]TCTTCAAATGATAGTAAAATAAAAAACGCATCGAAACCGGTGCGCCTGTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link