glt8d1

Ensembl ID:
ENSDARG00000040157
ZFIN ID:
ZDB-GENE-041114-23
Description:
Glycosyltransferase 8 domain-containing protein 1 [Source:UniProtKB/Swiss-Prot;Acc:Q5U3H3]
Human Orthologue:
GLT8D1
Human Description:
glycosyltransferase 8 domain containing 1 [Source:HGNC Symbol;Acc:24870]
Mouse Orthologue:
Glt8d1
Mouse Description:
glycosyltransferase 8 domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1923735]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15034 Essential Splice Site Available for shipment Available now
sa21836 Nonsense Mutation detected in F1 DNA During 2016
sa41767 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa15034
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058735 Essential Splice Site 145 365 5 10
Genomic Location:
Chromosome 11 (position 4039848)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTGGGWAAGATTCCTACTGATGCTCAGAAGATKGAGACMGTGARGCCGG[T/G]AAACATATATGCATTTRTTTCAATWGWATTRTATGRTGTGGAGCAAAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21836
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058735 Nonsense 229 365 8 10
Genomic Location:
Chromosome 11 (position 4037344)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAGCTACATTGGTTATCTGGACTTTAAGAAGGAAGCGATTAAGAAGCTT[G/T]GAATGAGAGCAAACACTTGCTCCTTCAATCCTGGAGTCTTCGTGGCCAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41767
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058735 Nonsense 261 365 8 10
Genomic Location:
Chromosome 11 (position 4037246)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATTTAACCGAGTGGAAGCAGCAGAACGTCACCAGTCAGCTTGAGTTCTG[G/A]ATGGAGCGCAATGCTAAGTTAGTTTTGTGTTCAGTTACTTGTGTTTGGCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Bipolar disorder: Large-scale genome-wide association analysis of bipolar disorder identifies a new susceptibility locus near ODZ4. (View Study)
  • Osteoarthritis: Identification of new susceptibility loci for osteoarthritis (arcOGEN): a genome-wide association study. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link