glt8d1

Ensembl ID:
ENSDARG00000040157
ZFIN ID:
ZDB-GENE-041114-23
Description:
Glycosyltransferase 8 domain-containing protein 1 [Source:UniProtKB/Swiss-Prot;Acc:Q5U3H3]
Human Orthologue:
GLT8D1
Human Description:
glycosyltransferase 8 domain containing 1 [Source:HGNC Symbol;Acc:24870]
Mouse Orthologue:
Glt8d1
Mouse Description:
glycosyltransferase 8 domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1923735]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15034 Essential Splice Site Available for shipment Available now
sa21836 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa15034
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058735 Essential Splice Site 145 365 5 10
Genomic Location:
Chromosome 11 (position 4039848)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTGGGWAAGATTCCTACTGATGCTCAGAAGATKGAGACMGTGARGCCGG[T/G]AAACATATATGCATTTRTTTCAATWGWATTRTATGRTGTGGAGCAAAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21836
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058735 Nonsense 229 365 8 10
Genomic Location:
Chromosome 11 (position 4037344)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAGCTACATTGGTTATCTGGACTTTAAGAAGGAAGCGATTAAGAAGCTT[G/T]GAATGAGAGCAAACACTTGCTCCTTCAATCCTGGAGTCTTCGTGGCCAAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Bipolar disorder: Large-scale genome-wide association analysis of bipolar disorder identifies a new susceptibility locus near ODZ4. (View Study)
  • Osteoarthritis: Identification of new susceptibility loci for osteoarthritis (arcOGEN): a genome-wide association study. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/yw9h140j