nek4

Ensembl ID:
ENSDARG00000040152
ZFIN ID:
ZDB-GENE-040426-1392
Description:
serine/threonine-protein kinase Nek4 [Source:RefSeq peptide;Acc:NP_957306]
Human Orthologue:
NEK4
Human Description:
NIMA (never in mitosis gene a)-related kinase 4 [Source:HGNC Symbol;Acc:11399]
Mouse Orthologue:
Nek4
Mouse Description:
NIMA (never in mitosis gene a)-related expressed kinase 4 Gene [Source:MGI Symbol;Acc:MGI:1344404]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6189 Essential Splice Site Mutation detected in F1 DNA During 2017
sa8401 Essential Splice Site Mutation detected in F1 DNA During 2017
sa21837 Nonsense Available for shipment Available now
sa31813 Essential Splice Site Available for shipment Available now
sa27717 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa6189
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058728 Essential Splice Site 118 849 2 16
Genomic Location (Zv9):
Chromosome 11 (position 4083263)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 4001767
KASP Assay ID:
554-4822.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAGAGACAGGTGGTGGAGTGGTTTGTTCAGATCGCCATGGCTCTTCAGG[T/C]AAGTTAATAGMCATTCTTCTCACTAGGGGTGTAAAAATACATCAATATTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8401
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058728 Essential Splice Site 221 849 5 16
Genomic Location (Zv9):
Chromosome 11 (position 4076882)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 3995386
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
WACCTCCTCGCATTATACTAACATCATTGATTATTTACTTTCAATATTCA[G/A]TTACCACAGATGCCRAGTAAGTACGACCCTCAGCTRGGAGAACTGATAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21837
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058728 Nonsense 277 849 6 16
Genomic Location (Zv9):
Chromosome 11 (position 4076631)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 3995135
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACGCATTGATCTGTCCTGTTACTGATTCTGAACAGGAAAACCGCCAAGT[C/A]ACGGAAAAATGCAGCGAATGGCAAACTGAACAGTGCTGGATCAGATGCGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31813
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058728 Essential Splice Site 316 849 6 16
Genomic Location (Zv9):
Chromosome 11 (position 4076511)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 3995015
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTTCAGCCACAGTGTCTCAACTCTGAGTCAAAGACCTGCGGAAAAAAGG[T/C]TAGAGGAATGCCATCTTGGAAATCTTATGCACGTGTGTTTTAAATCGACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27717
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058728 Nonsense 631 849 11 16
Genomic Location (Zv9):
Chromosome 11 (position 4065935)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 3984439
KASP Assay ID:
2260-3863.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTCAGCCAGAGAGAGGAGAAGACTGAAGCAGTCGCAGGAGAACTCCACA[C/T]AACAAGGTGTGAGGATTTCTGGGAATTCAATGTTATTTTAATGTAAATGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Bipolar disorder: Genome-wide association and meta-analysis of bipolar disorder in individuals of European ancestry. (View Study)
  • Bipolar disorder: Large-scale genome-wide association analysis of bipolar disorder identifies a new susceptibility locus near ODZ4. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link