LOC570238

Ensembl ID:
ENSDARG00000040135
Human Orthologue:
FOS
Human Description:
FBJ murine osteosarcoma viral oncogene homolog [Source:HGNC Symbol;Acc:3796]
Mouse Orthologue:
Fos
Mouse Description:
FBJ osteosarcoma oncogene Gene [Source:MGI Symbol;Acc:MGI:95574]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa36535 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa36535
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058706 Nonsense 71 352 2 4
Genomic Location (Zv9):
Chromosome 17 (position 50763333)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 50154150
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTGGATGGTCCAGCCGACCATCATCACCTCCGTGTCTCCGTCTCAAGGC[A/T]GAACCGACAGCAATGAACCGGCAAAGAGCAAACCAGCGGGAAACAAAGGG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link