psma2

Ensembl ID:
ENSDARG00000040121
ZFIN ID:
ZDB-GENE-050522-479
Description:
proteasome alpha 2 subunit [Source:RefSeq peptide;Acc:NP_001019612]
Human Orthologue:
PSMA2
Human Description:
proteasome (prosome, macropain) subunit, alpha type, 2 [Source:HGNC Symbol;Acc:9531]
Mouse Orthologue:
Psma2
Mouse Description:
proteasome (prosome, macropain) subunit, alpha type 2 Gene [Source:MGI Symbol;Acc:MGI:104885]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39125 Essential Splice Site Mutation detected in F1 DNA During 2017
sa28732 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa39125
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058680 Essential Splice Site 40 234 2 8
Genomic Location (Zv9):
Chromosome 16 (position 46262427)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 43440211
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATGCTCTGGCAGCTGTAGCTGCTGGTGCTCCTTCAGTTGGAATTAAAGG[T/C]TGGAACAATATATTTTCTTATTTATTTTATTAATTTTGCATGGCCTATAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28732
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058680 Nonsense 91 234 4 8
Genomic Location (Zv9):
Chromosome 16 (position 46263274)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 43439364
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGTTGTAAAAGTGTTTAATTATGTCTGCAGGGTTCTTGTGCGAAGGGCA[C/T]GAAAGCTGGCTCAGCAGTACTTCTTGGTCTATCAGGAGCCAATTCCTACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link