LOC569695

Ensembl ID:
ENSDARG00000040116
Human Orthologue:
ZNF366
Human Description:
zinc finger protein 366 [Source:HGNC Symbol;Acc:18316]
Mouse Orthologue:
Zfp366
Mouse Description:
zinc finger protein 366 Gene [Source:MGI Symbol;Acc:MGI:2178429]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa31625 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa31625
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058674 Nonsense 312 559 3 6
Genomic Location (Zv9):
Chromosome 8 (position 951659)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 902886
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGAAGAGCTTCCAGTACCCGAGTCAGCTGCAGAACCACATGATGAAGCAC[A/T]AGGACATCCGGCCGTTCATCTGCAGCGAGTGCGGGATGGAGTTCGTGCAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Hip geometry: Genome-wide association with bone mass and geometry in the Framingham Heart Study. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link