kif20bb

Ensembl ID:
ENSDARG00000040110
ZFIN ID:
ZDB-GENE-030131-9684
Description:
Sb:cb152 protein [Source:UniProtKB/TrEMBL;Acc:Q4KME4]
Human Orthologue:
KIF20B
Human Description:
kinesin family member 20B [Source:HGNC Symbol;Acc:7212]
Mouse Orthologue:
Kif20b
Mouse Description:
kinesin family member 20B Gene [Source:MGI Symbol;Acc:MGI:2444576]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22067 Essential Splice Site Available for shipment Available now
sa35243 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa22067
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058665 Essential Splice Site 418 988 14 20
Genomic Location (Zv9):
Chromosome 12 (position 17528215)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 16407973
KASP Assay ID:
2260-5190.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCACAGTTTTAAGACACTGAATTGTTTTGTTCTTACATTATTTTGTCCTT[A/T]GGTAGTTGTCCTCAACCCTAAACCAGCTCCAAGCATTGCACTCAAAAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35243
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058665 Essential Splice Site 678 988 18 20
Genomic Location (Zv9):
Chromosome 12 (position 17531051)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 16410809
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGTATTCAGATGCAGGATTTAAATGACCAACTTCTCCAGGCAACCAGGG[T/A]AAATTGAAATAAAGTTTTCTCCAAGATAAATATCTGATGTTACTGTGAAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link