tbcd

Ensembl ID:
ENSDARG00000040099
ZFIN ID:
ZDB-GENE-060823-1
Description:
Tbcd protein [Source:UniProtKB/TrEMBL;Acc:Q4V9C9]
Human Orthologue:
TBCD
Human Description:
tubulin folding cofactor D [Source:HGNC Symbol;Acc:11581]
Mouse Orthologue:
Tbcd
Mouse Description:
tubulin-specific chaperone d Gene [Source:MGI Symbol;Acc:MGI:1919686]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6045 Nonsense Mutation detected in F1 DNA During 2014
sa20134 Splice Site, Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa6045
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058645 None None 279 None 9
ENSDART00000114392 None None 328 None 10
ENSDART00000123290 None None 145 None 5
ENSDART00000125973 Nonsense 341 1191 10 39

The following transcripts of ENSDARG00000040099 do not overlap with this mutation:

Genomic Location:
Chromosome 3 (position 49413894)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGCCCAGTCTTCTGTCACTGAAAGTGTAGAGGCTACAAAACCTGATCTA[G/T]AGTCTGTTAGCCAGGAAGAAGACTATGACATACCTCAGGAGGTAGAGAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20134
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058645 None None 279 None 9
ENSDART00000114392 Splice Site, Nonsense 257 328 7 10
ENSDART00000123290 None None 145 None 5
ENSDART00000125973 Splice Site, Nonsense 1121 1191 36 39

The following transcripts of ENSDARG00000040099 do not overlap with this mutation:

Genomic Location:
Chromosome 3 (position 49486808)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAGAAAGTCTTAGTTCAGCTGTTGATGTTGCTCTGTCACCCCTTCCCTT[T/A]GGTAAGACACCAGTAGCAGATCAGATTTAGTCTAGACAATTTTGATGTAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/s3ehabe5