tbcd

Ensembl ID:
ENSDARG00000040099
ZFIN ID:
ZDB-GENE-060823-1
Description:
Tbcd protein [Source:UniProtKB/TrEMBL;Acc:Q4V9C9]
Human Orthologue:
TBCD
Human Description:
tubulin folding cofactor D [Source:HGNC Symbol;Acc:11581]
Mouse Orthologue:
Tbcd
Mouse Description:
tubulin-specific chaperone d Gene [Source:MGI Symbol;Acc:MGI:1919686]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6045 Nonsense Mutation detected in F1 DNA During 2015
sa26147 Nonsense Mutation detected in F1 DNA During 2015
sa20134 Splice Site, Nonsense Mutation detected in F1 DNA During 2015

Mutation Details

Allele Name:
sa6045
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058645   None 279 None 9
ENSDART00000114392   None 328 None 10
ENSDART00000123290   None 145 None 5
ENSDART00000125973 Nonsense 341 1191 10 39

The following transcripts of ENSDARG00000040099 do not overlap with this mutation:

Genomic Location:
Chromosome 3 (position 49413894)
KASP Assay ID:
554-3932.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGCCCAGTCTTCTGTCACTGAAAGTGTAGAGGCTACAAAACCTGATCTA[G/T]AGTCTGTTAGCCAGGAAGAAGACTATGACATACCTCAGGAGGTAGAGAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26147
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058645   None 279 None 9
ENSDART00000114392 Nonsense 154 328 4 10
ENSDART00000123290   None 145 None 5
ENSDART00000125973 Nonsense 1018 1191 33 39

The following transcripts of ENSDARG00000040099 do not overlap with this mutation:

Genomic Location:
Chromosome 3 (position 49481168)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATCTTTATTCGATTACCTAAAGGGCATCCAGCAGGACTTCACAATGCTT[C/T]AACAGTTTGGAGACACATTGTTACGCATCTTCAGAGATAATCTGCGCAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20134
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
T > A
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058645   None 279 None 9
ENSDART00000114392 Splice Site, Nonsense 257 328 7 10
ENSDART00000123290   None 145 None 5
ENSDART00000125973 Splice Site, Nonsense 1121 1191 36 39

The following transcripts of ENSDARG00000040099 do not overlap with this mutation:

Genomic Location:
Chromosome 3 (position 49486808)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAGAAAGTCTTAGTTCAGCTGTTGATGTTGCTCTGTCACCCCTTCCCTT[T/A]GGTAAGACACCAGTAGCAGATCAGATTTAGTCTAGACAATTTTGATGTAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/s3ehabe5