LOC570454

Ensembl ID:
ENSDARG00000040095
Human Orthologue:
THRAP3
Human Description:
thyroid hormone receptor associated protein 3 [Source:HGNC Symbol;Acc:22964]
Mouse Orthologue:
Thrap3
Mouse Description:
thyroid hormone receptor associated protein 3 Gene [Source:MGI Symbol;Acc:MGI:2442637]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa22908 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa22908
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076250 None None 714 None 8
ENSDART00000124838 Nonsense 916 921 10 10
Genomic Location:
Chromosome 16 (position 39917475)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTAAATGGGCTCATGATAAATTCCAGGCCACCGATGATGAGGGCGAACAA[C/T]AGAGAGAGGATGGGGAATAGGACCAGTGAGAATGGAGCAGTGAAGAATAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/qj0bp2vo