epb4.1l4

Ensembl ID:
ENSDARG00000040087
ZFIN ID:
ZDB-GENE-990415-20
Description:
Band 4.1-like protein 4 [Source:UniProtKB/Swiss-Prot;Acc:O57457]
Human Orthologue:
EPB41L4A
Human Description:
erythrocyte membrane protein band 4.1 like 4A [Source:HGNC Symbol;Acc:13278]
Mouse Orthologue:
Epb4.1l4a
Mouse Description:
erythrocyte protein band 4.1-like 4a Gene [Source:MGI Symbol;Acc:MGI:103007]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18493 Nonsense Available for shipment Available now
sa41567 Nonsense Mutation detected in F1 DNA During 2016
sa31759 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa18493
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058627 Nonsense 56 618 2 24
ENSDART00000123842   None 603 None 21
Genomic Location (Zv9):
Chromosome 10 (position 1825645)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 1771111
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTAGTGMTGGACTATGTGTTCAGTCAYGTGAACCTCGCAGAAACGGAGTA[T/A]TTTGGGCTTCGCTATTGCGACCGCAGCCATCAGACGGTGAGKTTTACAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41567
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058627 Nonsense 221 618 8 24
ENSDART00000123842 Nonsense 153 603 6 21
Genomic Location (Zv9):
Chromosome 10 (position 1802100)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 1747656
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATACATGTATTGTGTGTGTGTTTTTTCAGGGAGAAAAGCAGGCAGAGTA[T/A]TTCCTGGGACTTACGCCGGTCGGGGTCGTGGTTTACAAGAATAAAACCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31759
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058627 Essential Splice Site 361 618 13 24
ENSDART00000123842 Essential Splice Site 293 603 11 21
Genomic Location (Zv9):
Chromosome 10 (position 1786091)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 1731647
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGGAGCTCTCTGCACACAATAGCACTCATGTTTCGGAAATGTGTGTTTA[A/C]GGGCGAAACAATGGAGGTCAAGCGGTCACAAAGATGGAGAACACGAGCGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link