epb4.1l4

Ensembl ID:: ENSDARG00000040087
ZFIN ID:: ZDB-GENE-990415-20
Description:: Band 4.1-like protein 4 [Source:UniProtKB/Swiss-Prot;Acc:O57457]
Human Orthologue:: EPB41L4A
Human Description:: erythrocyte membrane protein band 4.1 like 4A [Source:HGNC Symbol;Acc:13278]
Mouse Orthologue:: Epb4.1l4a
Mouse Description:: erythrocyte protein band 4.1-like 4a Gene [Source:MGI Symbol;Acc:MGI:103007]

Alleles

There is 1 allele of this gene:

Allele name	Consequence	Status	Availability Estimate
sa18493	Nonsense	Available for shipment	Available now

Mutation Details

Allele Name:: sa18493
Current Status:: Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:: T > A
Consequence:: Nonsense

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000058627	Nonsense	56	618	2	24
ENSDART00000123842		None	603	None	21

Genomic Location:: Chromosome 10 (position 1825645)
KASP Assay ID:: None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:: GTAGTGMTGGACTATGTGTTCAGTCAYGTGAACCTCGCAGAAACGGAGTA[T/A]TTTGGGCTTCGCTATTGCGACCGCAGCCATCAGACGGTGAGKTTTACAGT
Associated Phenotype:: Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

vWF and FVIII levels: Combined analysis of three genome-wide association studies on vWF and FVIII plasma levels. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

OMIM

OMIM information for EPB41L4A

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: