
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
epb4.1l4
- Ensembl ID:
- ENSDARG00000040087
- ZFIN ID:
- ZDB-GENE-990415-20
- Description:
- Band 4.1-like protein 4 [Source:UniProtKB/Swiss-Prot;Acc:O57457]
- Human Orthologue:
- EPB41L4A
- Human Description:
- erythrocyte membrane protein band 4.1 like 4A [Source:HGNC Symbol;Acc:13278]
- Mouse Orthologue:
- Epb4.1l4a
- Mouse Description:
- erythrocyte protein band 4.1-like 4a Gene [Source:MGI Symbol;Acc:MGI:103007]
Alleles
There are 3 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa18493 | Nonsense | Available for shipment | Available now |
sa41567 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa31759 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa18493
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000058627 | Nonsense | 56 | 618 | 2 | 24 |
ENSDART00000123842 | None | 603 | None | 21 |
- Genomic Location (Zv9):
- Chromosome 10 (position 1825645)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 10 1771111 GRCz11 10 1798825 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GTAGTGMTGGACTATGTGTTCAGTCAYGTGAACCTCGCAGAAACGGAGTA[T/A]TTTGGGCTTCGCTATTGCGACCGCAGCCATCAGACGGTGAGKTTTACAGT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa41567
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000058627 | Nonsense | 221 | 618 | 8 | 24 |
ENSDART00000123842 | Nonsense | 153 | 603 | 6 | 21 |
- Genomic Location (Zv9):
- Chromosome 10 (position 1802100)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 10 1747656 GRCz11 10 1775402 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TATACATGTATTGTGTGTGTGTTTTTTCAGGGAGAAAAGCAGGCAGAGTA[T/A]TTCCTGGGACTTACGCCGGTCGGGGTCGTGGTTTACAAGAATAAAACCCA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa31759
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- A > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000058627 | Essential Splice Site | 361 | 618 | 13 | 24 |
ENSDART00000123842 | Essential Splice Site | 293 | 603 | 11 | 21 |
- Genomic Location (Zv9):
- Chromosome 10 (position 1786091)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 10 1731647 GRCz11 10 1759393 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ATGGAGCTCTCTGCACACAATAGCACTCATGTTTCGGAAATGTGTGTTTA[A/C]GGGCGAAACAATGGAGGTCAAGCGGTCACAAAGATGGAGAACACGAGCGA
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- vWF and FVIII levels: Combined analysis of three genome-wide association studies on vWF and FVIII plasma levels. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: