fli1b

Ensembl ID:
ENSDARG00000040080
ZFIN ID:
ZDB-GENE-031114-3
Description:
friend leukemia integration 1b [Source:RefSeq peptide;Acc:NP_001008780]
Human Orthologue:
FLI1
Human Description:
Friend leukemia virus integration 1 [Source:HGNC Symbol;Acc:3749]
Mouse Orthologue:
Fli1
Mouse Description:
Friend leukemia integration 1 Gene [Source:MGI Symbol;Acc:MGI:95554]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa36230 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa36230
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058613 Nonsense 186 467 4 9
ENSDART00000102789 Nonsense 176 458 4 9
ENSDART00000121474 Nonsense 176 458 5 10
ENSDART00000124717 Nonsense 176 485 4 10
ENSDART00000134010 Nonsense 176 457 4 9
Genomic Location (Zv9):
Chromosome 16 (position 44809417)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 42089925
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTCCCTCTTCCAGACCCTGGATGGAAAAGCGCTCTGCAAATTGAGCAAA[G/T]AGGACATGATGCGCATCACCTCCGCATACAACACAGACATCCTGCTCTCC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Hundreds of variants clustered in genomic loci and biological pathways affect human height. (View Study)
  • Myopia (pathological): A genome-wide association study provides evidence for association of chromosome 8p23 (MYP10) and 10q21.1 (MYP15) with high myopia in the French Population. (View Study)
  • Rheumatoid arthritis: Meta-analysis identifies nine new loci associated with rheumatoid arthritis in the Japanese population. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link