pycard

Ensembl ID:
ENSDARG00000040076
ZFIN ID:
ZDB-GENE-000511-2
Description:
Apoptosis-associated speck-like protein containing a CARD [Source:UniProtKB/Swiss-Prot;Acc:Q9I9N6]
Human Orthologues:
PYCARD, PYDC1
Human Descriptions:
PYD (pyrin domain) containing 1 [Source:HGNC Symbol;Acc:30261]
PYD and CARD domain containing [Source:HGNC Symbol;Acc:16608]
Mouse Orthologue:
Pycard
Mouse Description:
PYD and CARD domain containing Gene [Source:MGI Symbol;Acc:MGI:1931465]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa42794 Essential Splice Site, Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa42794
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Essential Splice Site, Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055921 Essential Splice Site 100 203 2 5
ENSDART00000059712 Splice Site None 203 None 5
Genomic Location (Zv9):
Chromosome 16 (position 44758984)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 42039492
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATCGCTTTTATTGTTTTTCAGCAGAAAGCAAAGGTGCTCCCTCTGATGG[T/G]GAGTAAGCGAATCACTTCACTAATCGGCAATGTGGCAGGCCGTTTAAACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link